WWW.WAS.ORG • WORLD AQUACULTURE • JUNE 2024 29 using HRPzyme-integrated primers was conducted. The successful amplification was confirmed through gel electrophoresis, demonstrating specific targeting of the 16S rRNA and tlh genes. Importantly, the HRPzyme sequence remained inactive during PCR, forming a G-quadruplex structure only after the target gene amplification, allowing for colorimetric detection. This innovative design minimizes false-positive results and enhances the specificity of the assay (Figure 2). Optimization of HRPzyme PCR based-Colorimetric assay We used two sets of primers for the molecular confirmation of V. parahaemolyticus: 16S rRNA (F: GGCGTAAAGCGCATGCAGGT, R: GAAATTCTACCCCCCTCTACAG) and tlh (F: ACTCAACACAAGAAGAGATCGACAA; R: GATGAGCGGTTGATGTCCAAA). The PCR procedures were performed under the following conditions: (1) 16S rRNA: denaturation at 95 °C for 3 min, followed by 34 cycles of denaturation at 95 °C for 30 sec, annealing at 58 °C for 30 sec, and primer extension at 72 °C for 1 min; followed by final extension at 72 °C for 5 min (2) tlh: denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 30 sec, annealing at 60 °C for 40 sec, and primer extension at 72 °C for 1 min; followed by final extension at 72 °C for 10 min. We obtained the sequence data of the tlh gene in V. parahaemolyticus from the NCBI GeneBank. Using SnapGene software (version 6.0), we designed the forward and reverse primers, which included a protector, HRPzyme sequence, spacer, and the complementary sequence to the targeted region in the tlh gene. In order to prevent unwanted folding of the HRPzyme sequence (GGGTAGGGCGGGTTGGGT) into a double strand in the presence of Hemin and to minimize background signals, we introduced various lengths of protector sequences (poly A) at the 5’ end of both the forward and reverse tlh primers. These lengths ranged from 0 to 20 nucleotides. In the next stage, we confirmed the amplification of the targeted region using specific HRPzyme-integrated primers through electrophoresis on a 2% agarose gel (Figure 2). To initiate the reaction, we mixed 8 µL of the PCR product with 5 µL of 500 µM hemin dissolved in MES buffer (containing 1% DMSO, 0.05% Triton X-100, 25 mM MES, 200 mM NaCl, 10 mM KCl, pH= 5.1) and allowed it to incubate for 30 minutes at room temperature. Subsequently, we added 50 µL of 10 mM ABTS, 2 µL of H2O2 (30%), and 1 mL of Citrate buffer (pH=4). The reaction’s absorbance was measured at OD = 410 nm. To optimize the HRPzyme-colorimetric reaction, we explored different primer concentrations (ranging from 15 to 750 nM), annealing temperatures (ranging from 40 to 65 °C), and reaction times (ranging from 5 to 60 minutes). These investigations were conducted using a concentration of 104 cfu mL-1 of V. parahaemolyticus, and data presented are based on 6 independent experiments (replicates = 3). Detection Optimized conditions included a primer concentration of 500 nM, an annealing temperature of 60°C, and an incubation time of 60 minutes. The optimal length of the polyadenine protector sequence was determined to be 10 nucleotides. This optimization process resulted in a highly sensitive and specific colorimetric assay capable of detecting V. parahaemolyticus at concentrations as low as 10 cfu mL-1 with a spectrophotometer and 103 cfu mL-1 visually. These findings highlight the robustness and versatility of our detection platform, which can be easily adapted for different sample types and environmental conditions (Figure 2). FIGURE 1. (a-c). Geographic location of sampling sites. Demonstrating (a) the location of the state of Delaware, (b) the location of Sally Cove (SC) and Sally Cove Control (SCC) sampling sites within the Rehoboth Bay in Delaware, and (c) the geographic coordinates of sampling sites (CONTINUED ON PAGE 30)
RkJQdWJsaXNoZXIy MjExNDY=